rs5930912 chrX:136247493 A>G
- Sequence
tagaggggctgtccttggacttat[A/G]aaatgaatgaactctgaggtgtta
- ASB for transcription factors
- ZN629_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN629_HUMAN | 2.93 | n/a | 4.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood