rs5933682 chrX:8815762 A>G
- Sequence
ggtgagagaccattatatatgaat[A/G]tgtaaataaataataacagaaaaa
- ASB in cell types
- MCF10AT1 (breast premetastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10AT1 (breast premetastatic epithelial cells) | n/a | 2.64 | 1.50 |
Items per page:
1 – 1 of 1