rs5934030 chrX:12701630 A>G
- Sequence
aaattcctaattgtttttacaaaa[A/G]gctaaatatttaaatagcagctcg
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | -4.19 | 2.58 | 1.50 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.70 | -1.96 | 1.33 |
Items per page:
1 – 2 of 2