rs5935694 chrX:14095791 C>T
- Sequence
ctggtcttcacagaatgcttcttc[C/T]cttggtacactccagtgtacgcat
- ASB in cell types
- WA09 (embryonic stem cells) adrenal gland
- ASB for transcription factors
- RAD21_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | -0.20 | 2.79 | 1.75 | n/a | n/a | |||
| CTCF_HUMAN | 0.30 | 1.37 | 1.81 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP nicotine dependence (smoking), smoking cessation in a trial of precessation nicotine replacement