rs5936084 chrX:15973406 C>G
- Sequence
tccttgggcttctgtaatcacctc[C/G]taactggtctccctacaaccactg
- ASB in cell types
- foreskin keratinocyte heart left ventricle GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.42 | -0.78 | 1.22 | |||
| heart left ventricle | n/a | 2.55 | 2.50 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 0.91 | -0.31 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood