rs5945157 chrX:153636445 C>T
- Sequence
catccaccatagggcaattctgac[C/T]acagccagccagggggcagtgctg
- ASB in cell types
- CD34+ hematopoietic stem cells GM19193 (female B-cells Lymphoblastoid Cell Lines) LUHMES (lund human mesencephalic cells) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- TIF1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TIF1B_HUMAN | 3.51 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1