rs5945333 chrX:153662433 A>G
- Sequence
gctatgactcccggcgcggcaccc[A/G]caacatataccgggaataccggga
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | n/a | 3.34 | 2.00 | |||
| K562 (myelogenous leukemia) | 2.33 | -3.87 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Thyroid, Whole_Blood