rs5945373 chrX:153400457 A>G
- Sequence
ccttccacactgggcgccccctaa[A/G]cccagctggcagcactccagtcta
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) GM10847 (female B-cells Lymphoblastoid Cell Lines) HEK293 (embryonic kidney)
- ASB for transcription factors
- CTCF_HUMAN LMBL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.09 | 3.08 | 1.86 | 0.93 | Weak Discordant | |||
| LMBL2_HUMAN | 2.92 | n/a | 3.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Liver, Nerve_Tibial