rs5949012 chrX:1604913 G>A
- Sequence
tgaaatttctcttctttgctgtag[G/A]ggtcagtagcagtaagtagcggct
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line) foreskin keratinocyte
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.77 | -0.49 | 1.31 | -0.40 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
