rs5957010 chrX:118459872 C>T
- Sequence
tgctcctatgttatacaaaggaat[C/T]atgagagaggtgttttacataatt
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines) SK-N-SH (neuroblastoma) GM10847 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.07 | 2.26 | 1.74 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Heart_Atrial_Appendage, Nerve_Tibial, Testis, Whole_Blood