rs5961886 chrX:5917162 C>T
- Sequence
ggcgaccataaattgccctgaaca[C/T]cttgcctgagcacaccttcctgtg
- ASB in cell types
- SK-N-SH (neuroblastoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | n/a | 3.00 | 1.00 | |||
| K562 (myelogenous leukemia) | -0.04 | 1.37 | 1.00 |
Items per page:
1 – 2 of 2