rs5980141 chrX:15242963 G>A
- Sequence
gtaaagtcacatttggattattgt[G/A]tacataggaaaagaaggaaacccg
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) GM10847 (female B-cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.64 | -2.86 | 1.50 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -0.70 | 1.08 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -2.92 | 1.12 | 1.50 |
Items per page:
1 – 3 of 3