rs5982723 chrX:2521611 C>T
- Sequence
ttgggaagccccctgcagaaagga[C/T]gtgcaaatgctaatcttcacaggg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived macrophages from peripheral blood monocyte-derived dendritic cells CD14+ monocytes
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.03 | 2.59 | 1.50 | n/a | No Hit | |||
| STAT1_HUMAN | 0.14 | 2.28 | 1.67 | n/a | No Hit |
Items per page:
1 – 2 of 2