rs5985402 chrX:109713087 G>A
- Sequence
ggatgaagggaagaagggaagaag[G/A]gaaggggaagggaaagggatggga
- ASB in cell types
- glioblastoma patient-derived cell model GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma patient-derived cell model | 2.87 | n/a | 2.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 1.90 | n/a | 2.00 |
Items per page:
1 – 2 of 2