rs5987447 chrX:51614712 A>G
- Sequence
agccttttcagtagatgtgaagat[A/G]cagatgagaagatggaaatggcac
- ASB in cell types
- glioblastoma patient-derived cell model
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma patient-derived cell model | 2.05 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Stomach, Testis, Thyroid