rs5989631 chrX:324376 G>C
- Sequence
gataaaaagccatagatggccggg[G/C]gcggtggctcaggcctgtcatccc
- ASB in cell types
- foreskin keratinocyte neural progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.35 | -4.26 | 2.00 | |||
| neural progenitors | -2.41 | 2.65 | 1.00 |
Items per page:
1 – 2 of 2