rs5989676 chrX:1559820 T>C
- Sequence
gtttttcttataatcatgcagtgt[T/C]gtttgtaggatactctacaggttt
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | -3.01 | 3.06 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 2.30 | -1.98 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | 2.01 | -3.69 | 1.50 |
Items per page:
1 – 3 of 3