rs5991110 chrX:115950441 G>A
- Sequence
tgccttcatgacaaaccagaaagc[G/A]gtccccttggaccactctggggat
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -1.08 | 1.99 | 2.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 2.34 | n/a | 2.00 |
Items per page:
1 – 2 of 2