rs5994188 chr22:17171571 G>A
- Sequence
acagtgacgcgagggactccgagg[G/A]cacccgggccggggtggacacggg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HEK293 (embryonic kidney) ID00015 (lymphoblastoid cell) hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.95 | 0.28 | 1.10 | |||
| HEK293 (embryonic kidney) | 0.17 | 0.91 | 1.97 | |||
| ID00015 (lymphoblastoid cell) | 1.85 | -1.63 | 1.00 | |||
| hepatocytes | 0.08 | 1.41 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Thyroid