rs5995886 chr22:40637797 G>A
- Sequence
gcaacagggagaaaggagaaaggc[G/A]aaaggggagagagcaacaaggtaa
- ASB in cell types
- MCF10A (breast epithelial cells) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- NCOA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NCOA3_HUMAN | -3.06 | 3.12 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, drotrecogin alfa treatment response to severe sepsis, fasting blood glucose, mitral annular calcium, parkinsons disease, rheumatoid arthritis
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood