rs5996460 chr22:23050912 A>G
- Sequence
tcctagaactgaaaaaagaattca[A/G]caaagtttctggatacaaaattaa
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.72 | -0.01 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Frontal_Cortex_BA9, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood