rs5997408 chr22:28811927 G>A
- Sequence
taattctcaggcacgccctcaccc[G/A]gttccggtttcccctaatgttaac
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM19238 (female B-cells lymphoblastoid cell lines) GM12892 (female B-cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN SPI1_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.52 | -1.08 | 1.04 | -4.02 | Concordant | |||
| SPI1_HUMAN | 0.20 | 1.23 | 1.35 | 2.56 | Concordant | |||
| STAG1_HUMAN | 1.85 | -0.37 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid