rs5998709 chr22:33049327 A>G
- Sequence
aaggtgggctccccctgctggaca[A/G]ctccactaccagcacgttcttcct
- ASB in cell types
- gastrocnemius medialis esophagus squamous epithelium MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| gastrocnemius medialis | -2.24 | 2.63 | 1.00 | |||
| esophagus squamous epithelium | -1.63 | 1.97 | 1.00 | |||
| MDM(monocyte derived macrophages) | 2.26 | n/a | 2.00 |
Items per page:
1 – 3 of 3