rs6000754 chr22:37512101 C>T
- Sequence
cgtggctgtcttcacagcttcaaa[C/T]aaaatcccatgcccctaaccaatc
- ASB in cell types
- CHL-1 (Melanoma)
- ASB for transcription factors
- BRD4_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 2.42 | 0.07 | 3.00 | n/a | n/a | |||
| ESR1_HUMAN | 1.42 | 1.51 | 1.20 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, refractive error
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Stomach