rs6000755 chr22:37512183 T>G
- Sequence
ggtatggggggtgggcagctgtgg[T/G]gtgaccaccaagctgggagcagac
- ASB in cell types
- CHL-1 (Melanoma)
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 2.02 | -0.50 | 2.40 | n/a | n/a |
Items per page:
1 – 1 of 1