rs6000790 chr22:22061882 A>G
- Sequence
ctgctggtctggtgtattgtggct[A/G]tataggggggtgcaaagaaattct
- ASB in cell types
- epithelial cell of prostate GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | 2.19 | -1.91 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 2.06 | -2.00 | 6.00 |
Items per page:
1 – 2 of 2