rs6001331 chr22:22201546 C>G
- Sequence
gtctggtccctgcgagtgcacctg[C/G]gggagaggcaatggggaaacacat
- ASB in cell types
- glioblastoma patient-derived cell model GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma patient-derived cell model | 2.63 | -2.42 | 1.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 1.40 | -0.12 | 1.00 |
Items per page:
1 – 2 of 2