rs6001690 chr22:22291216 C>A
- Sequence
gccagggctatgacagagccaggg[C/A]aagtccttggcagggccaggttcc
- ASB in cell types
- liver
- ASB for transcription factors
- RXRA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RXRA_HUMAN | 2.43 | -4.79 | 3.75 | n/a | No Hit |
Items per page:
1 – 1 of 1