rs6002045 chr22:40711714 G>A
- Sequence
atttacagagacatgagtcatcga[G/A]aggctatctaaaccgagataagct
- ASB in cell types
- HEK293 (embryonic kidney) BEAS-2B (bronchial epithelium) 22RV1 (prostate carcinoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- GCR_HUMAN ANDR_HUMAN TF65_HUMAN TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.41 | 0.80 | 1.11 | n/a | No Hit | |||
| ANDR_HUMAN | 2.18 | 0.95 | 2.00 | n/a | No Hit | |||
| TF65_HUMAN | 1.43 | 0.06 | 2.00 | n/a | No Hit | |||
| TCF21_HUMAN | 2.19 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, aortic valve calcium, fasting blood glucose, ldl cholesterol change with statins, rheumatoid arthritis, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Uterus, Whole_Blood