rs6002668 chr22:42278597 G>A
- Sequence
ctggcggcttagcccagggcacag[G/A]aggaggctgcctgggtttggcgct
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 1.59 | -0.79 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -0.97 | 1.66 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood