rs6002686 chr22:42314046 G>A
- Sequence
ggtgctctgtctgctgtgttcaga[G/A]ctgtgacctttgtgcctacatagc
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) VCaP (prostate carcinoma) HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -2.45 | 2.99 | 1.33 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -2.31 | 1.14 | 1.33 | |||
| VCaP (prostate carcinoma) | -0.05 | 1.65 | 1.88 | |||
| HMEC (human mammary epithelial cells) | 1.30 | -0.80 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood