rs6003925 chr22:23849800 T>C
- Sequence
aacgggggcgggacccgggcgcgg[T/C]gagcccattcattccccgagggct
- ASB in cell types
- erythroid cells MM1.S (plasma cell myeloma) hASC (preadipocytes)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 1.83 | -4.48 | 2.00 | |||
| MM1.S (plasma cell myeloma) | 1.40 | 0.22 | 1.17 | |||
| hASC (preadipocytes) | 1.94 | -1.71 | 1.00 |
Items per page:
1 – 3 of 3