rs6005863 chr22:28760460 A>G
- Sequence
ggtatgctaatagacggctgaaaa[A/G]ttggcagccaaatttggtttaaag
- ASB in cell types
- HUES64 (embryonic stem cells) iPS-derived dermal fibroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUES64 (embryonic stem cells) | -1.31 | 1.53 | 1.22 | |||
| iPS-derived dermal fibroblasts | -2.13 | 2.27 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), amyotrophic lateral sclerosis (als), amyotrophic lateral sclerosis (als) age of onset, autism, hdl cholesterol, triglycerides, waist hip ratio
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid