rs60060302 chr11:71253353 C>G
- Sequence
ttttctcaaggccttaatcattca[C/G]tgggagtctcccccagtacgagct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HEK293 (embryonic kidney)
- ASB for transcription factors
- ZBT20_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZBT20_HUMAN | -2.66 | 2.57 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1