rs6007551 chr22:45264192 G>A
- Sequence
ctctcagaggaggaggcattgaca[G/A]gagatgatctcagggcagacagtt
- ASB in cell types
- GM17942 (lymphoblastoid cell) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | 2.64 | n/a | 2.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 1.99 | -1.14 | 1.33 |
Items per page:
1 – 2 of 2