rs6008735 chr22:48492539 A>G
- Sequence
tctttctcgtgtgctgggatccat[A/G]tagaaggagatgggctccaccgtc
- ASB in cell types
- GM23338 HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23338 | n/a | 3.42 | 1.33 | |||
| HCT-116 (colon carcinoma) | 0.63 | 2.62 | 1.72 |
Items per page:
1 – 2 of 2