rs6008801 chr22:46122398 C>G
- Sequence
cgtccttgcatggccaggccccca[C/G]atctcctaagtcacttaagcccag
- ASB in cell types
- erythroid cells pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.54 | -1.75 | 2.00 | |||
| pancreas | -2.34 | 2.29 | 1.00 |
Items per page:
1 – 2 of 2