rs6010226 chr22:50276187 G>A
- Sequence
tcagtgtctccctgtgtgacgcac[G/A]gctgtggatggacccacagggacg
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) upper lobe of left lung pancreas adrenal gland
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.28 | 0.24 | 1.37 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol change with statins, ldl cholesterol, microalbuminuria, obesity with early age of onset (age >2), rheumatoid arthritis, serum creatinine, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio