rs6011456 chr20:62899372 T>G
- Sequence
ggtatctttaatgatgtttaacgc[T/G]caccttgttgcaagttagggttac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.01 | 0.76 | 1.22 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, body mass index (bmi), college completion, myocardial infarction (mi), years of education
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Breast_Mammary_Tissue, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood