rs6011478 chr20:62925419 A>G
- Sequence
catggaacacggggtatatagcaa[A/G]gttatgtgaatataccgaaaagac
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.00 | 0.95 | 1.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting insulin, homa-b, homa-ir, resistance to kuru in aged women despite likely exposure, schizophrenia, tetrology of fallot
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid, Whole_Blood