rs6011921 chr20:63602541 G>A
- Sequence
cacttcctctttcttagcccgtgt[G/A]aggcagcatctgtaagatgcttta
- ASB in cell types
- macrophages form periferal blood monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.59 | 0.41 | 1.45 | n/a | No Hit |
Items per page:
1 – 1 of 1