rs6012009 chr20:46689047 C>G
- Sequence
cagaaggagaaactgagggaaatc[C/G]agcttcggagcgcaggggagtccc
- ASB in cell types
- breast tumor HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.67 | n/a | 2.00 | |||
| HEK293 (embryonic kidney) | 0.03 | 0.69 | 2.02 |
Items per page:
1 – 2 of 2