rs6012712 chr20:49680716 A>G
- Sequence
aatcaagttctggaaacgaatagt[A/G]gtaatggttgcgtaatattgagaa
- ASB in cell types
- JB6 (Human anaplastic large cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| JB6 (Human anaplastic large cell lymphoma) | -1.47 | 1.58 | 2.00 |
Items per page:
1 – 1 of 1