rs6013649 chr20:53217485 G>A
- Sequence
tcagaacagcaacgccagtgaacc[G/A]ttgcacatcacttaatttgccagg
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.78 | 0.15 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, arthritis including non-rheumatoid, body mass index (bmi), infant head circumference, rheumatoid arthritis, tetrology of fallot