rs6013827 chr20:53905650 C>G
- Sequence
attaataaaggatgtgccatagag[C/G]gggtggaggactcagtgggcagaa
- ASB for transcription factors
- NFXL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFXL1_HUMAN | 3.23 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, fasting blood glucose, ldl cholesterol change with statins, microalbuminuria, serum creatinine