rs6013842 chr20:53941560 T>G
- Sequence
taataagtaaataaataataataa[T/G]aagaaagtcatttttgctccctcc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -1.39 | 1.92 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.76 | 0.03 | 1.38 |
Items per page:
1 – 2 of 2