rs6013845 chr20:53949732 G>T
- Sequence
gagctgaatgctgcctctgtctct[G/T]acaacctgtggaatgttcagcaaa
- ASB for transcription factors
- NFXL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFXL1_HUMAN | 3.11 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, cystatin c in serum, mitral annular calcium, salmonella-induced pyroptosis, simpson-angus scale, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio, years of education