rs60146347 chr9:137130213 C>A
- Sequence
gcgggggccgagggaaggaccgga[C/A]cctcccgaggtcgcggacccggcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 2.06 | n/a | 1.00 | |||
| primary B-CLL cells | 1.71 | -0.46 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Artery_Tibial, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg