rs6014947 chr20:57169443 C>T
- Sequence
aaggcaggcttacaccaagagcca[C/T]gtcagaaatgccacctccaaatcg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.07 | 1.91 | 4.38 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, diastolic blood pressure (dbp), obesity with early age of onset (age >2), paternal transmission distortion, prop taste detection threshold, stabilized warfarin dose, systolic blood pressure (sbp), transmission distortion
GTEx eQTL Brain_Cerebellum, Brain_Cortex, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg