rs6016742 chr20:42308404 T>A
- Sequence
gtcatgggtgagtcaaggcggtca[T/A]cagctgggacacagacacaagtcc
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCASMC (Human coronary artery smooth muscle cells) | 1.45 | -0.63 | 1.00 |
Items per page:
1 – 1 of 1